Review



phospho fak tyr397 antibody  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Cell Signaling Technology Inc phospho fak tyr397 antibody
    Phospho Fak Tyr397 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1026 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+fak/Phospho-FAK+(Tyr397)+Antibody/pmc13655228-58-139-147
    Average 96 stars, based on 1026 article reviews
    phospho fak tyr397 antibody - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    other:

    Article Title: The focal adhesion kinases regulate leptin action and the weight reducing effect of HDAC6 inhibition.
    Article Snippet: Anti-phosphoSTAT3Y705 (#9145 and #9131, 1:1000), anti-STAT3 (#9139, 1:1000), anti-phosphoPYK2Y402 (#3291, 1:1000), anti-PYK2 (#3480, 1:1000), anti- GAPDH HRP conjugate (#8884, 1:10,000), antiphosphoFAKY397 (#8556, 1:1000), and anti-FAK (#13009, 1:1000), antialpha Tubulin (#3873, 1:5000), anti-acetyl alpha tubulin (#5335, 1:2000), anti-FLAG tag (#14793, 1:5000), anti-myc tag (#2278, 1:2000) HRP-conjugated anti-rabbit IgG (#7074, 1:2000), HRP-conjugated antimouse IgG (#7076, 1:2000), DyLight 800-conjugated anti-rabbit IgG (#5151, 1:10,000), DyLight 680-conjugated anti-mouse IgG (#5470, 1:10,000) antibodies were purchased from Cell Signaling Technology Inc. (Danvers, MA) and were diluted as indicated.

    Article Title: The focal adhesion kinases regulate leptin action and the weight reducing effect of HDAC6 inhibition
    Article Snippet: Mice were anesthetized with isoflurane, and a stainless-steel guide cannula (Plastics One, Roanoke, VA) was implanted into the lateral ventricle using the following stereotaxic coordinates: AP: −0.46 mm, ML: −1.00 mm, DV: −2.20 mm.

    Incubation:

    Article Title: Splice isoform-perturbation coupled to single cell transcriptome profiling reveals functions of microexons in neurogenesis and autism-linked pathways.
    Article Snippet: .. Membranes were then washed 3 times in TBS-T and incubated with 1:1000 anti-FAK (Cell Signaling, 3285) or 1:1000 anti-p44/42 MAPK (Erk1/2) (Cell Signaling, 9102) in 5% milk TBS-T, or 1:1000 anti-Phospho-FAK (Y397) (Cell Signaling, 3283) or 1:1000 antiPhospho-p44/42MAPK (Erk1/2) (Thr202/Tyr204) (Cell Signaling, 9101) in 5% BSA TBS-T overnight at 4 °C. .. gDNA from transduced CGR8s was harvested and integrated hgRNA sequences were amplified using Q5 Ultra polymerase (NEB) ((1) 98 °C, 30 s; (2) 98 °C, 10 s; (3) 65 °C, 30 s; (4) 72 °C 20 s; (5) 72 °C 2min; steps 2-4 were repeated 25 times) primers: CROP-Cas9-F_s[N]: ACACGACGCTCTTCCGATCT[N]CTTGTGGAAAGGACGAAACACC CROP-Cas12a-R_s[N]: CTGGAGTTCAGACGTGTGCTCTTCCGATCT [N]GTGTCTCAAGATCTAGTTACGCCAAGC Where [N] indicates intervening nucleotides to generate staggered amplicons to increase library diversity.

    Article Title: Peptides for the treatment of cancer and/or metastasis
    Article Snippet: Proteins were separated by 8% SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) and transferred onto PVDF (Polyvinylidene fluoride) membranes (GE Healthcare). .. After blocking with 5% BSA (Bovine serum albumin) in TBS-T (tris-buffered saline-tween) for 1 hour, membranes were incubated overnight with primary antibodies dilution at 4° C. The antibodies were the following: anti-α9-Integrin monoclonal antibody clone 3E4 (Novus Biologicals) diluted 1:1000, anti-FAK (Cell Signaling) diluted 1:1000, anti-Phospho-FAK at Tyr397 (Cell Signaling) diluted 1:1000 and anti-actin (Santa Cruz Biotechnology) diluted 1:10000. ..

    Article Title: Splice isoform-perturbation coupled to single cell transcriptome profiling reveals functions of microexons in neurogenesis and autism-linked pathways
    Article Snippet: .. Membranes were then washed 3 times in TBS-T and incubated with 1:1000 anti-FAK (Cell Signaling, 3285) or 1:1000 anti-p44/42 MAPK (Erk1/2) (Cell Signaling, 9102) in 5% milk TBS-T, or 1:1000 anti-Phospho-FAK (Y397) (Cell Signaling, 3283) or 1:1000 anti-Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (Cell Signaling, 9101) in 5% BSA TBS-T overnight at 4 °C. .. gDNA from transduced CGR8s was harvested and integrated hgRNA sequences were amplified using Q5 Ultra polymerase (NEB) ((1) 98 °C, 30 s; (2) 98 °C, 10 s; (3) 65 °C, 30 s; (4) 72 °C 20 s; (5) 72 °C 2 min; steps 2-4 were repeated 25 times) primers: CROP-Cas9-F_s[N]: ACACGACGCTCTTCCGATCT[N]CTTGTGGAAAGGACGAAACACC CROP-Cas12a-R_s[N]: CTGGAGTTCAGACGTGTGCTCTTCCGATCT[N]GTGTCTCAAGATCTAGTTACGCCAAGC Where [N] indicates intervening nucleotides to generate staggered amplicons to increase library diversity.

    Blocking Assay:

    Article Title: Peptides for the treatment of cancer and/or metastasis
    Article Snippet: Proteins were separated by 8% SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) and transferred onto PVDF (Polyvinylidene fluoride) membranes (GE Healthcare). .. After blocking with 5% BSA (Bovine serum albumin) in TBS-T (tris-buffered saline-tween) for 1 hour, membranes were incubated overnight with primary antibodies dilution at 4° C. The antibodies were the following: anti-α9-Integrin monoclonal antibody clone 3E4 (Novus Biologicals) diluted 1:1000, anti-FAK (Cell Signaling) diluted 1:1000, anti-Phospho-FAK at Tyr397 (Cell Signaling) diluted 1:1000 and anti-actin (Santa Cruz Biotechnology) diluted 1:10000. ..

    Saline:

    Article Title: Peptides for the treatment of cancer and/or metastasis
    Article Snippet: Proteins were separated by 8% SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) and transferred onto PVDF (Polyvinylidene fluoride) membranes (GE Healthcare). .. After blocking with 5% BSA (Bovine serum albumin) in TBS-T (tris-buffered saline-tween) for 1 hour, membranes were incubated overnight with primary antibodies dilution at 4° C. The antibodies were the following: anti-α9-Integrin monoclonal antibody clone 3E4 (Novus Biologicals) diluted 1:1000, anti-FAK (Cell Signaling) diluted 1:1000, anti-Phospho-FAK at Tyr397 (Cell Signaling) diluted 1:1000 and anti-actin (Santa Cruz Biotechnology) diluted 1:10000. ..

    Western Blot:

    Article Title: A genome-wide genetic screen reveals the P2Y2-integrin axis as a stabilizer of EGFR mutants in non–small cell lung cancer (NSCLC)
    Article Snippet: .. The following antibodies were used for immunoblotting and/or IP: pY1068-EGFR (Thermo Fisher Scientific, cat. no. 44-788G); Mouse anti-EGF Receptor [13/EGFR (RUO) BD Biosciences, cat. no. 555996]; anti-GFP (Abcam; ab290); anti-Lamp1 [Cell Signaling Technology (CST), cat. no. 9091]; anti–phospho-AKT (CST, no. 4060); anti-AKT (CST, no. 9272); anti–phospho-ERK1/2 (CST, cat. no. 9102); anti-ERK1/2 (CST, cat. no. 4370); anti–phospho-FAK (Tyr 397 ) (CST, cat. no. 3283); anti-FAK (CST, cat. no. 3285); anti–Integrin Beta1 (Developmental Studies Hybridoma Bank; clone AIIB2); anti-FLAG M2 clone for Western blotting (Sigma-Aldrich, cat. no. F3165); EZview Red ANTI-FLAG M2 Affinity Gel for IP (Sigma-Aldrich, cat. no. F2426); ChromoTek GFP-Trap magnetic agarose (Proteintech, cat. no. gtma); anti–β-Actin-HRP [Santa Cruz Biotechnology (SCBT), sc-47778 HRP]; anti-rabbit IgG-HRP (SCBT, sc-2357) and m-IgGκ BP-HRP (SCBT, sc-516102); recombinant human EGF (Sino Biological, cat. no. 10605-HNAE); ATP (Sigma-Aldrich, cat. no. A1852); apyrase (Sigma-Aldrich, cat. no. A6535); RGDS peptide (Sigma-Aldrich, cat. no. A9041); PF-562271 (Selleck Chemicals, cat. no. S2890); AR-C 118925XX (Tocris Bioscience, cat. no. 4890); osimertinib (MedChemExpress, cat. no. HY-15772); kaempferol (MedChemExpress, cat. no. HY-14590). .. To establish HEK293 stable cells expressing EGFR, lentiviruses were generated using pHAGE-EGFR-WT and pHAGE-EGFR-L747_T751delLREAT (19del) plasmids (Addgene plasmid nos.

    Cell-Signaling:

    Article Title: A genome-wide genetic screen reveals the P2Y2-integrin axis as a stabilizer of EGFR mutants in non–small cell lung cancer (NSCLC)
    Article Snippet: .. The following antibodies were used for immunoblotting and/or IP: pY1068-EGFR (Thermo Fisher Scientific, cat. no. 44-788G); Mouse anti-EGF Receptor [13/EGFR (RUO) BD Biosciences, cat. no. 555996]; anti-GFP (Abcam; ab290); anti-Lamp1 [Cell Signaling Technology (CST), cat. no. 9091]; anti–phospho-AKT (CST, no. 4060); anti-AKT (CST, no. 9272); anti–phospho-ERK1/2 (CST, cat. no. 9102); anti-ERK1/2 (CST, cat. no. 4370); anti–phospho-FAK (Tyr 397 ) (CST, cat. no. 3283); anti-FAK (CST, cat. no. 3285); anti–Integrin Beta1 (Developmental Studies Hybridoma Bank; clone AIIB2); anti-FLAG M2 clone for Western blotting (Sigma-Aldrich, cat. no. F3165); EZview Red ANTI-FLAG M2 Affinity Gel for IP (Sigma-Aldrich, cat. no. F2426); ChromoTek GFP-Trap magnetic agarose (Proteintech, cat. no. gtma); anti–β-Actin-HRP [Santa Cruz Biotechnology (SCBT), sc-47778 HRP]; anti-rabbit IgG-HRP (SCBT, sc-2357) and m-IgGκ BP-HRP (SCBT, sc-516102); recombinant human EGF (Sino Biological, cat. no. 10605-HNAE); ATP (Sigma-Aldrich, cat. no. A1852); apyrase (Sigma-Aldrich, cat. no. A6535); RGDS peptide (Sigma-Aldrich, cat. no. A9041); PF-562271 (Selleck Chemicals, cat. no. S2890); AR-C 118925XX (Tocris Bioscience, cat. no. 4890); osimertinib (MedChemExpress, cat. no. HY-15772); kaempferol (MedChemExpress, cat. no. HY-14590). .. To establish HEK293 stable cells expressing EGFR, lentiviruses were generated using pHAGE-EGFR-WT and pHAGE-EGFR-L747_T751delLREAT (19del) plasmids (Addgene plasmid nos.

    Recombinant:

    Article Title: A genome-wide genetic screen reveals the P2Y2-integrin axis as a stabilizer of EGFR mutants in non–small cell lung cancer (NSCLC)
    Article Snippet: .. The following antibodies were used for immunoblotting and/or IP: pY1068-EGFR (Thermo Fisher Scientific, cat. no. 44-788G); Mouse anti-EGF Receptor [13/EGFR (RUO) BD Biosciences, cat. no. 555996]; anti-GFP (Abcam; ab290); anti-Lamp1 [Cell Signaling Technology (CST), cat. no. 9091]; anti–phospho-AKT (CST, no. 4060); anti-AKT (CST, no. 9272); anti–phospho-ERK1/2 (CST, cat. no. 9102); anti-ERK1/2 (CST, cat. no. 4370); anti–phospho-FAK (Tyr 397 ) (CST, cat. no. 3283); anti-FAK (CST, cat. no. 3285); anti–Integrin Beta1 (Developmental Studies Hybridoma Bank; clone AIIB2); anti-FLAG M2 clone for Western blotting (Sigma-Aldrich, cat. no. F3165); EZview Red ANTI-FLAG M2 Affinity Gel for IP (Sigma-Aldrich, cat. no. F2426); ChromoTek GFP-Trap magnetic agarose (Proteintech, cat. no. gtma); anti–β-Actin-HRP [Santa Cruz Biotechnology (SCBT), sc-47778 HRP]; anti-rabbit IgG-HRP (SCBT, sc-2357) and m-IgGκ BP-HRP (SCBT, sc-516102); recombinant human EGF (Sino Biological, cat. no. 10605-HNAE); ATP (Sigma-Aldrich, cat. no. A1852); apyrase (Sigma-Aldrich, cat. no. A6535); RGDS peptide (Sigma-Aldrich, cat. no. A9041); PF-562271 (Selleck Chemicals, cat. no. S2890); AR-C 118925XX (Tocris Bioscience, cat. no. 4890); osimertinib (MedChemExpress, cat. no. HY-15772); kaempferol (MedChemExpress, cat. no. HY-14590). .. To establish HEK293 stable cells expressing EGFR, lentiviruses were generated using pHAGE-EGFR-WT and pHAGE-EGFR-L747_T751delLREAT (19del) plasmids (Addgene plasmid nos.



    Similar Products

    anti fak  (MedChemExpress)
    94
    MedChemExpress anti fak
    Anti Fak, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+fak/FAK+Antibody/pmc13624094-102-15-16
    Average 94 stars, based on 1 article reviews
    anti fak - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    phospho fak tyr397 antibody  (Cell Signaling Technology Inc)
    96
    Cell Signaling Technology Inc phospho fak tyr397 antibody
    Phospho Fak Tyr397 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+fak/Phospho-FAK+(Tyr397)+Antibody/pmc13655228-58-139-147
    Average 96 stars, based on 1 article reviews
    phospho fak tyr397 antibody - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    p fak tyr397  (Cell Signaling Technology Inc)
    99
    Cell Signaling Technology Inc p fak tyr397
    Q209R preferentially engages FAK‐YAP signaling. (A) Western blot analysis of GNAQ, BAP1, Melan‐A, p‐ERK1/2 (Thr202/Tyr204), ERK1/2, FRA1, p‐AKT (Ser473), AKT, p‐4EBP1 (Ser65), and 4EBP1 expression in mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . HSP90 was used as an internal loading control. (B) Quantification of the relative ratio between p‐AKT (Ser473) and AKT in Q209R and Q209L UM cell lines from (A). (C) Quantification of the relative ratio between p‐4EBP1 (Ser65) and 4EBP1 in Q209R and Q209L UM cell lines from (A). (D) Western blot analysis of p‐FAK <t>(Tyr397),</t> FAK, p‐YAP (Ser127), and YAP in mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . HSP90 was used as an internal loading control. (E) Quantification of the relative ratio between p‐FAK (Tyr397) and FAK in Q209R and Q209L UM cell lines from (D). (F) Quantification of the relative ratio between p‐YAP (Ser127) and YAP in Q209R and Q209L UM cell lines from (D). Orthotopic tumor‐derived cell lines (QBM12.1 [Q209R], QBM12.3 [Q209R], QBM24 [Q209R], QBM45 [Q209L], QBM47 [Q209L]) and liver metastatic lines (QBM12L [Q209R], QBM12L2 [Q209R], QBM51L [Q209L], QBM53L [Q209L]) were used in A–F. (G) Representative IHC images showing YAP expression in primary tumors from Gnaq CA ; Bap1 CKO ; Myc CKI mice harboring either GNAQ Q209R or GNAQ Q209L . (H) Quantification of the nuclear‐to‐cytoplasmic YAP intensity ratio (H‐score) among primary tumors from Gnaq CA ; Bap1 CKO ; Myc CKI mice harboring either GNAQ Q209R or GNAQ Q209L . (I) Representative IHC images showing YAP expression in liver metastasis derived from intrasplenic transplantation of mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . (J) Quantification of nuclear YAP intensity (H‐score) among liver metastasis derived from intrasplenic transplantation of mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L .
    P Fak Tyr397, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+fak/Phospho-Akt+(Ser473)+XP+Rabbit+mAb/pmc13635764-42-35-37
    Average 99 stars, based on 1 article reviews
    p fak tyr397 - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    fak  (Cell Signaling Technology Inc)
    96
    Cell Signaling Technology Inc fak
    Q209R preferentially engages <t>FAK‐YAP</t> signaling. (A) Western blot analysis of GNAQ, BAP1, Melan‐A, p‐ERK1/2 (Thr202/Tyr204), ERK1/2, <t>FRA1,</t> <t>p‐AKT</t> (Ser473), AKT, p‐4EBP1 (Ser65), and 4EBP1 expression in mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . HSP90 was used as an internal loading control. (B) Quantification of the relative ratio between p‐AKT (Ser473) and AKT in Q209R and Q209L UM cell lines from (A). (C) Quantification of the relative ratio between p‐4EBP1 (Ser65) and 4EBP1 in Q209R and Q209L UM cell lines from (A). (D) Western blot analysis of p‐FAK (Tyr397), FAK, p‐YAP (Ser127), and YAP in mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . HSP90 was used as an internal loading control. (E) Quantification of the relative ratio between p‐FAK (Tyr397) and FAK in Q209R and Q209L UM cell lines from (D). (F) Quantification of the relative ratio between p‐YAP (Ser127) and YAP in Q209R and Q209L UM cell lines from (D). Orthotopic tumor‐derived cell lines (QBM12.1 [Q209R], QBM12.3 [Q209R], QBM24 [Q209R], QBM45 [Q209L], QBM47 [Q209L]) and liver metastatic lines (QBM12L [Q209R], QBM12L2 [Q209R], QBM51L [Q209L], QBM53L [Q209L]) were used in A–F. (G) Representative IHC images showing YAP expression in primary tumors from Gnaq CA ; Bap1 CKO ; Myc CKI mice harboring either GNAQ Q209R or GNAQ Q209L . (H) Quantification of the nuclear‐to‐cytoplasmic YAP intensity ratio (H‐score) among primary tumors from Gnaq CA ; Bap1 CKO ; Myc CKI mice harboring either GNAQ Q209R or GNAQ Q209L . (I) Representative IHC images showing YAP expression in liver metastasis derived from intrasplenic transplantation of mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . (J) Quantification of nuclear YAP intensity (H‐score) among liver metastasis derived from intrasplenic transplantation of mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L .
    Fak, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+fak/FAK+Antibody/pmc13635764-42-40-41
    Average 96 stars, based on 1 article reviews
    fak - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    anti fak  (Proteintech)
    96
    Proteintech anti fak
    Q209R preferentially engages <t>FAK‐YAP</t> signaling. (A) Western blot analysis of GNAQ, BAP1, Melan‐A, p‐ERK1/2 (Thr202/Tyr204), ERK1/2, <t>FRA1,</t> <t>p‐AKT</t> (Ser473), AKT, p‐4EBP1 (Ser65), and 4EBP1 expression in mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . HSP90 was used as an internal loading control. (B) Quantification of the relative ratio between p‐AKT (Ser473) and AKT in Q209R and Q209L UM cell lines from (A). (C) Quantification of the relative ratio between p‐4EBP1 (Ser65) and 4EBP1 in Q209R and Q209L UM cell lines from (A). (D) Western blot analysis of p‐FAK (Tyr397), FAK, p‐YAP (Ser127), and YAP in mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . HSP90 was used as an internal loading control. (E) Quantification of the relative ratio between p‐FAK (Tyr397) and FAK in Q209R and Q209L UM cell lines from (D). (F) Quantification of the relative ratio between p‐YAP (Ser127) and YAP in Q209R and Q209L UM cell lines from (D). Orthotopic tumor‐derived cell lines (QBM12.1 [Q209R], QBM12.3 [Q209R], QBM24 [Q209R], QBM45 [Q209L], QBM47 [Q209L]) and liver metastatic lines (QBM12L [Q209R], QBM12L2 [Q209R], QBM51L [Q209L], QBM53L [Q209L]) were used in A–F. (G) Representative IHC images showing YAP expression in primary tumors from Gnaq CA ; Bap1 CKO ; Myc CKI mice harboring either GNAQ Q209R or GNAQ Q209L . (H) Quantification of the nuclear‐to‐cytoplasmic YAP intensity ratio (H‐score) among primary tumors from Gnaq CA ; Bap1 CKO ; Myc CKI mice harboring either GNAQ Q209R or GNAQ Q209L . (I) Representative IHC images showing YAP expression in liver metastasis derived from intrasplenic transplantation of mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . (J) Quantification of nuclear YAP intensity (H‐score) among liver metastasis derived from intrasplenic transplantation of mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L .
    Anti Fak, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+fak/FAK+Antibody/10__1038_slash_s41419___026___09318___4-58-69-74
    Average 96 stars, based on 1 article reviews
    anti fak - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    anti phospho fak  (MedChemExpress)
    94
    MedChemExpress anti phospho fak
    Q209R preferentially engages <t>FAK‐YAP</t> signaling. (A) Western blot analysis of GNAQ, BAP1, Melan‐A, p‐ERK1/2 (Thr202/Tyr204), ERK1/2, <t>FRA1,</t> <t>p‐AKT</t> (Ser473), AKT, p‐4EBP1 (Ser65), and 4EBP1 expression in mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . HSP90 was used as an internal loading control. (B) Quantification of the relative ratio between p‐AKT (Ser473) and AKT in Q209R and Q209L UM cell lines from (A). (C) Quantification of the relative ratio between p‐4EBP1 (Ser65) and 4EBP1 in Q209R and Q209L UM cell lines from (A). (D) Western blot analysis of p‐FAK (Tyr397), FAK, p‐YAP (Ser127), and YAP in mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . HSP90 was used as an internal loading control. (E) Quantification of the relative ratio between p‐FAK (Tyr397) and FAK in Q209R and Q209L UM cell lines from (D). (F) Quantification of the relative ratio between p‐YAP (Ser127) and YAP in Q209R and Q209L UM cell lines from (D). Orthotopic tumor‐derived cell lines (QBM12.1 [Q209R], QBM12.3 [Q209R], QBM24 [Q209R], QBM45 [Q209L], QBM47 [Q209L]) and liver metastatic lines (QBM12L [Q209R], QBM12L2 [Q209R], QBM51L [Q209L], QBM53L [Q209L]) were used in A–F. (G) Representative IHC images showing YAP expression in primary tumors from Gnaq CA ; Bap1 CKO ; Myc CKI mice harboring either GNAQ Q209R or GNAQ Q209L . (H) Quantification of the nuclear‐to‐cytoplasmic YAP intensity ratio (H‐score) among primary tumors from Gnaq CA ; Bap1 CKO ; Myc CKI mice harboring either GNAQ Q209R or GNAQ Q209L . (I) Representative IHC images showing YAP expression in liver metastasis derived from intrasplenic transplantation of mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . (J) Quantification of nuclear YAP intensity (H‐score) among liver metastasis derived from intrasplenic transplantation of mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L .
    Anti Phospho Fak, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+fak/Phospho-FAK+(Tyr397)+Antibody/pmc13624094-102-10-11
    Average 94 stars, based on 1 article reviews
    anti phospho fak - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    fak  (Proteintech)
    96
    Proteintech fak
    A Representative immunoblotting analysis ( n = 3 independent experiments) of phosphorylated EPHA2 and <t>FAK</t> (EPHA2 Y588 and FAK Y397) in A549 <t>(oe</t> <t>GLUD1</t> versus vector). B Representative immunoblotting analysis ( n = 3 independent experiments) of VE-Cadherin protein expression in whole-cell lysates (WCL) and membrane fractions of A549/DTX (si GLUD1 versus siNC; left) and A549 (oe GLUD1 versus vector; right). C Immunofluorescence staining of VE-Cadherin in A549/DTX (si GLUD1 versus siNC; top) and A549 (oe GLUD1 versus vector; bottom), with quantification shown in ( D ), n = 3 biologically independent samples. The average fluorescence intensity of VE-Cadherin on the cell membrane surface was calculated by manually selecting the area using FIJI. E Representative immunoblotting analysis ( n = 3 independent experiments) of VE-Cadherin and GLUD1 in A549 WCL following GLUD1 overexpression and subsequent CDH5 knockdown. F – K Representative images ( F – H ) and quantification ( I – K ) of adhesion ( F , I , n = 4 biologically independent samples), barrier-destruction ( G , J , n = 3 biologically independent samples) and transmigration ( H , K , n = 3 biologically independent samples) for siNC or si GLUD1 -treated A549 cells. Cells in ( F , H ) were counted using Fiji. G fluorescence was quantified using Fiji and normalized to the 30-min value within each experiment. L – O Immunofluorescence analysis of intravasation ( L ) and extravasation ( M ) in A549 cells following GLUD1 overexpression and subsequent CDH5 knockdown. Intravasation was quantified by tumor cells’ average fluorescence intensity in adjacent channels ( N , n = 4 biologically independent samples), while extravasation was measured by ECM-invading cells ( O , n = 3 biologically independent samples). All data were normalized to oe GLUD1 − /si CDH5 − group. All data are represented as mean ± SEM. P values were calculated using two-tailed unpaired Student’s t test D ; one-way ANOVA followed by Dunnett’s multiple-comparisons test ( I , K , N , O ); two-way ANOVA followed by Šídák multiple-comparisons test J . Scale bars: C , G , 20 μm; F , H , 1000 μm. Source data are provided as a Source Data file. For immunoblots, samples within each panel were derived from the same experiment, with separate gels processed in parallel where applicable; detailed gel assignments are provided in the Methods.
    Fak, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+fak/FAK+Antibody/pmc13627656-412-35-38
    Average 96 stars, based on 1 article reviews
    fak - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    p fak  (Cell Signaling Technology Inc)
    96
    Cell Signaling Technology Inc p fak
    A Representative immunoblotting analysis ( n = 3 independent experiments) of phosphorylated EPHA2 and <t>FAK</t> (EPHA2 Y588 and FAK Y397) in A549 <t>(oe</t> <t>GLUD1</t> versus vector). B Representative immunoblotting analysis ( n = 3 independent experiments) of VE-Cadherin protein expression in whole-cell lysates (WCL) and membrane fractions of A549/DTX (si GLUD1 versus siNC; left) and A549 (oe GLUD1 versus vector; right). C Immunofluorescence staining of VE-Cadherin in A549/DTX (si GLUD1 versus siNC; top) and A549 (oe GLUD1 versus vector; bottom), with quantification shown in ( D ), n = 3 biologically independent samples. The average fluorescence intensity of VE-Cadherin on the cell membrane surface was calculated by manually selecting the area using FIJI. E Representative immunoblotting analysis ( n = 3 independent experiments) of VE-Cadherin and GLUD1 in A549 WCL following GLUD1 overexpression and subsequent CDH5 knockdown. F – K Representative images ( F – H ) and quantification ( I – K ) of adhesion ( F , I , n = 4 biologically independent samples), barrier-destruction ( G , J , n = 3 biologically independent samples) and transmigration ( H , K , n = 3 biologically independent samples) for siNC or si GLUD1 -treated A549 cells. Cells in ( F , H ) were counted using Fiji. G fluorescence was quantified using Fiji and normalized to the 30-min value within each experiment. L – O Immunofluorescence analysis of intravasation ( L ) and extravasation ( M ) in A549 cells following GLUD1 overexpression and subsequent CDH5 knockdown. Intravasation was quantified by tumor cells’ average fluorescence intensity in adjacent channels ( N , n = 4 biologically independent samples), while extravasation was measured by ECM-invading cells ( O , n = 3 biologically independent samples). All data were normalized to oe GLUD1 − /si CDH5 − group. All data are represented as mean ± SEM. P values were calculated using two-tailed unpaired Student’s t test D ; one-way ANOVA followed by Dunnett’s multiple-comparisons test ( I , K , N , O ); two-way ANOVA followed by Šídák multiple-comparisons test J . Scale bars: C , G , 20 μm; F , H , 1000 μm. Source data are provided as a Source Data file. For immunoblots, samples within each panel were derived from the same experiment, with separate gels processed in parallel where applicable; detailed gel assignments are provided in the Methods.
    P Fak, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+fak/Phospho-FAK+(Tyr397)+Antibody/10__36922_slash_ijb026240252-76-20-22
    Average 96 stars, based on 1 article reviews
    p fak - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    Q209R preferentially engages FAK‐YAP signaling. (A) Western blot analysis of GNAQ, BAP1, Melan‐A, p‐ERK1/2 (Thr202/Tyr204), ERK1/2, FRA1, p‐AKT (Ser473), AKT, p‐4EBP1 (Ser65), and 4EBP1 expression in mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . HSP90 was used as an internal loading control. (B) Quantification of the relative ratio between p‐AKT (Ser473) and AKT in Q209R and Q209L UM cell lines from (A). (C) Quantification of the relative ratio between p‐4EBP1 (Ser65) and 4EBP1 in Q209R and Q209L UM cell lines from (A). (D) Western blot analysis of p‐FAK (Tyr397), FAK, p‐YAP (Ser127), and YAP in mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . HSP90 was used as an internal loading control. (E) Quantification of the relative ratio between p‐FAK (Tyr397) and FAK in Q209R and Q209L UM cell lines from (D). (F) Quantification of the relative ratio between p‐YAP (Ser127) and YAP in Q209R and Q209L UM cell lines from (D). Orthotopic tumor‐derived cell lines (QBM12.1 [Q209R], QBM12.3 [Q209R], QBM24 [Q209R], QBM45 [Q209L], QBM47 [Q209L]) and liver metastatic lines (QBM12L [Q209R], QBM12L2 [Q209R], QBM51L [Q209L], QBM53L [Q209L]) were used in A–F. (G) Representative IHC images showing YAP expression in primary tumors from Gnaq CA ; Bap1 CKO ; Myc CKI mice harboring either GNAQ Q209R or GNAQ Q209L . (H) Quantification of the nuclear‐to‐cytoplasmic YAP intensity ratio (H‐score) among primary tumors from Gnaq CA ; Bap1 CKO ; Myc CKI mice harboring either GNAQ Q209R or GNAQ Q209L . (I) Representative IHC images showing YAP expression in liver metastasis derived from intrasplenic transplantation of mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . (J) Quantification of nuclear YAP intensity (H‐score) among liver metastasis derived from intrasplenic transplantation of mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L .

    Journal: Pigment Cell & Melanoma Research

    Article Title: Allele‐Specific GNAQ Q209 Mutations Reveal Context‐Dependent Oncogenic Programs in Uveal Melanoma

    doi: 10.1111/pcmr.70121

    Figure Lengend Snippet: Q209R preferentially engages FAK‐YAP signaling. (A) Western blot analysis of GNAQ, BAP1, Melan‐A, p‐ERK1/2 (Thr202/Tyr204), ERK1/2, FRA1, p‐AKT (Ser473), AKT, p‐4EBP1 (Ser65), and 4EBP1 expression in mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . HSP90 was used as an internal loading control. (B) Quantification of the relative ratio between p‐AKT (Ser473) and AKT in Q209R and Q209L UM cell lines from (A). (C) Quantification of the relative ratio between p‐4EBP1 (Ser65) and 4EBP1 in Q209R and Q209L UM cell lines from (A). (D) Western blot analysis of p‐FAK (Tyr397), FAK, p‐YAP (Ser127), and YAP in mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . HSP90 was used as an internal loading control. (E) Quantification of the relative ratio between p‐FAK (Tyr397) and FAK in Q209R and Q209L UM cell lines from (D). (F) Quantification of the relative ratio between p‐YAP (Ser127) and YAP in Q209R and Q209L UM cell lines from (D). Orthotopic tumor‐derived cell lines (QBM12.1 [Q209R], QBM12.3 [Q209R], QBM24 [Q209R], QBM45 [Q209L], QBM47 [Q209L]) and liver metastatic lines (QBM12L [Q209R], QBM12L2 [Q209R], QBM51L [Q209L], QBM53L [Q209L]) were used in A–F. (G) Representative IHC images showing YAP expression in primary tumors from Gnaq CA ; Bap1 CKO ; Myc CKI mice harboring either GNAQ Q209R or GNAQ Q209L . (H) Quantification of the nuclear‐to‐cytoplasmic YAP intensity ratio (H‐score) among primary tumors from Gnaq CA ; Bap1 CKO ; Myc CKI mice harboring either GNAQ Q209R or GNAQ Q209L . (I) Representative IHC images showing YAP expression in liver metastasis derived from intrasplenic transplantation of mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . (J) Quantification of nuclear YAP intensity (H‐score) among liver metastasis derived from intrasplenic transplantation of mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L .

    Article Snippet: Antibodies against GNAQ (CST, #14373, RRID:AB_2665457), BAP1 (Abcam, ab255611), Melan‐A (Abcam, ab210546, RRID:AB_2889292), ERK1/2 (CST, #4695, RRID:AB_390779), p‐ERK1/2 (Thr202/Tyr204) (CST, #4370, RRID:AB_2315112), FRA1 (Abcam, ab252421, RRID:AB_2904513), AKT (CST, #4691, RRID:AB_915783), p‐AKT (Ser473) (CST, #4060, RRID:AB_2315049), p‐FAK (Tyr397) (CST, #8556, RRID:AB_10891442), FAK (CST, #3285, RRID:AB_2269034), 4E‐BP1 (CST, #9452, RRID:AB_331692), p‐4E‐BP1 (Ser65; CST, #9451, RRID:AB_330947), YAP (CST, #4912, RRID:AB_2218911), and p‐YAP (Ser127) (CST, #4911, RRID:AB_2218913) were used at 1:1000 as indicated.

    Techniques: Western Blot, Analysis, Expressing, Control, Derivative Assay, Transplantation Assay

    Q209R preferentially engages FAK‐YAP signaling. (A) Western blot analysis of GNAQ, BAP1, Melan‐A, p‐ERK1/2 (Thr202/Tyr204), ERK1/2, FRA1, p‐AKT (Ser473), AKT, p‐4EBP1 (Ser65), and 4EBP1 expression in mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . HSP90 was used as an internal loading control. (B) Quantification of the relative ratio between p‐AKT (Ser473) and AKT in Q209R and Q209L UM cell lines from (A). (C) Quantification of the relative ratio between p‐4EBP1 (Ser65) and 4EBP1 in Q209R and Q209L UM cell lines from (A). (D) Western blot analysis of p‐FAK (Tyr397), FAK, p‐YAP (Ser127), and YAP in mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . HSP90 was used as an internal loading control. (E) Quantification of the relative ratio between p‐FAK (Tyr397) and FAK in Q209R and Q209L UM cell lines from (D). (F) Quantification of the relative ratio between p‐YAP (Ser127) and YAP in Q209R and Q209L UM cell lines from (D). Orthotopic tumor‐derived cell lines (QBM12.1 [Q209R], QBM12.3 [Q209R], QBM24 [Q209R], QBM45 [Q209L], QBM47 [Q209L]) and liver metastatic lines (QBM12L [Q209R], QBM12L2 [Q209R], QBM51L [Q209L], QBM53L [Q209L]) were used in A–F. (G) Representative IHC images showing YAP expression in primary tumors from Gnaq CA ; Bap1 CKO ; Myc CKI mice harboring either GNAQ Q209R or GNAQ Q209L . (H) Quantification of the nuclear‐to‐cytoplasmic YAP intensity ratio (H‐score) among primary tumors from Gnaq CA ; Bap1 CKO ; Myc CKI mice harboring either GNAQ Q209R or GNAQ Q209L . (I) Representative IHC images showing YAP expression in liver metastasis derived from intrasplenic transplantation of mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . (J) Quantification of nuclear YAP intensity (H‐score) among liver metastasis derived from intrasplenic transplantation of mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L .

    Journal: Pigment Cell & Melanoma Research

    Article Title: Allele‐Specific GNAQ Q209 Mutations Reveal Context‐Dependent Oncogenic Programs in Uveal Melanoma

    doi: 10.1111/pcmr.70121

    Figure Lengend Snippet: Q209R preferentially engages FAK‐YAP signaling. (A) Western blot analysis of GNAQ, BAP1, Melan‐A, p‐ERK1/2 (Thr202/Tyr204), ERK1/2, FRA1, p‐AKT (Ser473), AKT, p‐4EBP1 (Ser65), and 4EBP1 expression in mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . HSP90 was used as an internal loading control. (B) Quantification of the relative ratio between p‐AKT (Ser473) and AKT in Q209R and Q209L UM cell lines from (A). (C) Quantification of the relative ratio between p‐4EBP1 (Ser65) and 4EBP1 in Q209R and Q209L UM cell lines from (A). (D) Western blot analysis of p‐FAK (Tyr397), FAK, p‐YAP (Ser127), and YAP in mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . HSP90 was used as an internal loading control. (E) Quantification of the relative ratio between p‐FAK (Tyr397) and FAK in Q209R and Q209L UM cell lines from (D). (F) Quantification of the relative ratio between p‐YAP (Ser127) and YAP in Q209R and Q209L UM cell lines from (D). Orthotopic tumor‐derived cell lines (QBM12.1 [Q209R], QBM12.3 [Q209R], QBM24 [Q209R], QBM45 [Q209L], QBM47 [Q209L]) and liver metastatic lines (QBM12L [Q209R], QBM12L2 [Q209R], QBM51L [Q209L], QBM53L [Q209L]) were used in A–F. (G) Representative IHC images showing YAP expression in primary tumors from Gnaq CA ; Bap1 CKO ; Myc CKI mice harboring either GNAQ Q209R or GNAQ Q209L . (H) Quantification of the nuclear‐to‐cytoplasmic YAP intensity ratio (H‐score) among primary tumors from Gnaq CA ; Bap1 CKO ; Myc CKI mice harboring either GNAQ Q209R or GNAQ Q209L . (I) Representative IHC images showing YAP expression in liver metastasis derived from intrasplenic transplantation of mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L . (J) Quantification of nuclear YAP intensity (H‐score) among liver metastasis derived from intrasplenic transplantation of mouse UM cell lines harboring GNAQ Q209R or GNAQ Q209L .

    Article Snippet: Antibodies against GNAQ (CST, #14373, RRID:AB_2665457), BAP1 (Abcam, ab255611), Melan‐A (Abcam, ab210546, RRID:AB_2889292), ERK1/2 (CST, #4695, RRID:AB_390779), p‐ERK1/2 (Thr202/Tyr204) (CST, #4370, RRID:AB_2315112), FRA1 (Abcam, ab252421, RRID:AB_2904513), AKT (CST, #4691, RRID:AB_915783), p‐AKT (Ser473) (CST, #4060, RRID:AB_2315049), p‐FAK (Tyr397) (CST, #8556, RRID:AB_10891442), FAK (CST, #3285, RRID:AB_2269034), 4E‐BP1 (CST, #9452, RRID:AB_331692), p‐4E‐BP1 (Ser65; CST, #9451, RRID:AB_330947), YAP (CST, #4912, RRID:AB_2218911), and p‐YAP (Ser127) (CST, #4911, RRID:AB_2218913) were used at 1:1000 as indicated.

    Techniques: Western Blot, Analysis, Expressing, Control, Derivative Assay, Transplantation Assay

    A Representative immunoblotting analysis ( n = 3 independent experiments) of phosphorylated EPHA2 and FAK (EPHA2 Y588 and FAK Y397) in A549 (oe GLUD1 versus vector). B Representative immunoblotting analysis ( n = 3 independent experiments) of VE-Cadherin protein expression in whole-cell lysates (WCL) and membrane fractions of A549/DTX (si GLUD1 versus siNC; left) and A549 (oe GLUD1 versus vector; right). C Immunofluorescence staining of VE-Cadherin in A549/DTX (si GLUD1 versus siNC; top) and A549 (oe GLUD1 versus vector; bottom), with quantification shown in ( D ), n = 3 biologically independent samples. The average fluorescence intensity of VE-Cadherin on the cell membrane surface was calculated by manually selecting the area using FIJI. E Representative immunoblotting analysis ( n = 3 independent experiments) of VE-Cadherin and GLUD1 in A549 WCL following GLUD1 overexpression and subsequent CDH5 knockdown. F – K Representative images ( F – H ) and quantification ( I – K ) of adhesion ( F , I , n = 4 biologically independent samples), barrier-destruction ( G , J , n = 3 biologically independent samples) and transmigration ( H , K , n = 3 biologically independent samples) for siNC or si GLUD1 -treated A549 cells. Cells in ( F , H ) were counted using Fiji. G fluorescence was quantified using Fiji and normalized to the 30-min value within each experiment. L – O Immunofluorescence analysis of intravasation ( L ) and extravasation ( M ) in A549 cells following GLUD1 overexpression and subsequent CDH5 knockdown. Intravasation was quantified by tumor cells’ average fluorescence intensity in adjacent channels ( N , n = 4 biologically independent samples), while extravasation was measured by ECM-invading cells ( O , n = 3 biologically independent samples). All data were normalized to oe GLUD1 − /si CDH5 − group. All data are represented as mean ± SEM. P values were calculated using two-tailed unpaired Student’s t test D ; one-way ANOVA followed by Dunnett’s multiple-comparisons test ( I , K , N , O ); two-way ANOVA followed by Šídák multiple-comparisons test J . Scale bars: C , G , 20 μm; F , H , 1000 μm. Source data are provided as a Source Data file. For immunoblots, samples within each panel were derived from the same experiment, with separate gels processed in parallel where applicable; detailed gel assignments are provided in the Methods.

    Journal: Nature Communications

    Article Title: α-KG conformationally stabilizes nuclear GLUD1-SNAIL complex to fuel trans-endothelial migration in metastasis

    doi: 10.1038/s41467-026-77149-0

    Figure Lengend Snippet: A Representative immunoblotting analysis ( n = 3 independent experiments) of phosphorylated EPHA2 and FAK (EPHA2 Y588 and FAK Y397) in A549 (oe GLUD1 versus vector). B Representative immunoblotting analysis ( n = 3 independent experiments) of VE-Cadherin protein expression in whole-cell lysates (WCL) and membrane fractions of A549/DTX (si GLUD1 versus siNC; left) and A549 (oe GLUD1 versus vector; right). C Immunofluorescence staining of VE-Cadherin in A549/DTX (si GLUD1 versus siNC; top) and A549 (oe GLUD1 versus vector; bottom), with quantification shown in ( D ), n = 3 biologically independent samples. The average fluorescence intensity of VE-Cadherin on the cell membrane surface was calculated by manually selecting the area using FIJI. E Representative immunoblotting analysis ( n = 3 independent experiments) of VE-Cadherin and GLUD1 in A549 WCL following GLUD1 overexpression and subsequent CDH5 knockdown. F – K Representative images ( F – H ) and quantification ( I – K ) of adhesion ( F , I , n = 4 biologically independent samples), barrier-destruction ( G , J , n = 3 biologically independent samples) and transmigration ( H , K , n = 3 biologically independent samples) for siNC or si GLUD1 -treated A549 cells. Cells in ( F , H ) were counted using Fiji. G fluorescence was quantified using Fiji and normalized to the 30-min value within each experiment. L – O Immunofluorescence analysis of intravasation ( L ) and extravasation ( M ) in A549 cells following GLUD1 overexpression and subsequent CDH5 knockdown. Intravasation was quantified by tumor cells’ average fluorescence intensity in adjacent channels ( N , n = 4 biologically independent samples), while extravasation was measured by ECM-invading cells ( O , n = 3 biologically independent samples). All data were normalized to oe GLUD1 − /si CDH5 − group. All data are represented as mean ± SEM. P values were calculated using two-tailed unpaired Student’s t test D ; one-way ANOVA followed by Dunnett’s multiple-comparisons test ( I , K , N , O ); two-way ANOVA followed by Šídák multiple-comparisons test J . Scale bars: C , G , 20 μm; F , H , 1000 μm. Source data are provided as a Source Data file. For immunoblots, samples within each panel were derived from the same experiment, with separate gels processed in parallel where applicable; detailed gel assignments are provided in the Methods.

    Article Snippet: The antibodies used were shown as followed: VE-Cadherin (ab33168; 1:1000, Abcam), Lamin B (ab16048; 1:5000, Abcam), Sodium/Potassium ATPase alpha 1 (ab308329; 1:1000, Abcam), FLAG (ab205606; 1:10,000, Abcam), ACTIN (ab8226, 1:2000, Abcam), GLUD1 (14299-1-AP; 1:1000, Proteintech), FAK (12636-1-AP; 1:1000, Proteintech), EPHA2 (25749-1-AP; 1:1000, Proteintech), SNAIL (13099-1-AP; 1:1000, Proteintech), β-Tubulin (80713-1-RR; 1:1000, Proteintech), Phospho-FAK (83933-1-RR, 1:1000, Proteintech), Phospho-EPHA2 (25749-1-AP, 1:1000, Proteintech), SOX2 (11064-1-AP, 1:500, Proteintech), SLUG (12129-1-AP, 1:500, Proteintech), ZEB1 (21544-1-AP, 1:500, Proteintech).

    Techniques: Western Blot, Analysis, Plasmid Preparation, Expressing, Membrane, Immunofluorescence, Staining, Fluorescence, Over Expression, Knockdown, Transmigration Assay, Two Tailed Test, Derivative Assay